Membrane:Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4
Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4 Article ll OPEN ACCESS Article ll OPEN ACCESS
Recombinant:Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4
Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4 Article ll OPEN ACCESS Article ll OPEN ACCESS
Transfection:Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4
Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4 Article ll OPEN ACCESS Article ll OPEN ACCESS
Agarose Gel Electrophoresis:Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4
Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4 Article ll OPEN ACCESS Article ll OPEN ACCESS
Plasmid Preparation:Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4
Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4 Article ll OPEN ACCESS Article ll OPEN ACCESS
Extraction:Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4
Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4 Article ll OPEN ACCESS Article ll OPEN ACCESS
Bicinchoninic Acid Protein Assay:Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4
Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4 Article ll OPEN ACCESS Article ll OPEN ACCESS
Staining:Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4
Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4 Article ll OPEN ACCESS Article ll OPEN ACCESS
RNA Extraction:Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4
Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4 Article ll OPEN ACCESS Article ll OPEN ACCESS
H&E Stain:Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4
Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4 Article ll OPEN ACCESS Article ll OPEN ACCESS
Viability Assay:Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4
Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4 Article ll OPEN ACCESS Article ll OPEN ACCESS
Reporter Assay:Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4
Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4 Article ll OPEN ACCESS Article ll OPEN ACCESS
Labeling:Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4
Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4 Article ll OPEN ACCESS Article ll OPEN ACCESS
Western Blot:Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4
Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4 Article ll OPEN ACCESS Article ll OPEN ACCESS
Metabolomic:Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4
Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4 Article ll OPEN ACCESS Article ll OPEN ACCESS
RNA sequencing:Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4
Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4 Article ll OPEN ACCESS Article ll OPEN ACCESS
Sequencing:Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4
Article Title: KRAS G12D -driven pentose phosphate pathway remodeling imparts a targetable vulnerability synergizing with MRTX1133 for durable remissions in PDAC
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit anti-ERK1/2 Polyclonal antibody Proteintech Cat#11257-1-AP; RRID: AB_2139822 Goat Anti-Mouse IgG (H + L) HRP Bioworld Cat#BS12478; RRID: AB_2773727 Goat Anti-Rabbit IgG (H + L) HRP Bioworld Cat#BS13278; RRID: AB_2773728 Bacterial and virus strains DH5a Chemically Competent Cell AngYuBio Cat#G6016 SgRNA of UBE2T -#1 (GAGCTCGCAGGTCATCCATT) This manuscript N/A SgRNA of UBE2T -#2 (CATCCAAACATTGATTCTGC) This manuscript N/A SgRNA of UBE2T -#3 (TCTTGCCAACATGTGATGCC) This manuscript N/A Biological samples Human PDAC tissue This manuscript N/A Patient-derived xenografts (PDX) This manuscript N/A Genetically engineered mice pancreas sample This manuscript N/A KPC/UKPC allografts This manuscript N/A AsPC-1-derived xenografts This manuscript N/A Chemicals, peptides, and recombinant proteins Ulixertinib MedChemExpress Cat#HY-15816 RRx-001 MedChemExpress Cat#HY-16438 PFK-158 MedChemExpress Cat#HY-12203 PKM2-IN-1 MedChemExpress Cat#HY-103617 CPI-613 MedChemExpress Cat#HY-15453 Palbociclib MedChemExpress Cat# HY-50767 Pentagalloylglucose MedChemExpress Cat#HY-N0527 MRTX1133 MedChemExpress Cat#HY-134813 DAPI Solarbio Cat#C0060 Cell Counting Kit-8 (CCK-8) Selleck Cat#B34302 Basement Membrane Matrix High Concentration Corning Cat#354248 Advanced DMEM/F12 Gibco Cat#12634010 B27 Supplement (50x) Gibco Cat#17504044 N-Acetylcysteine Sigma Cat#A9165 Recombinant murine EGF Peprotech Cat#315-09 Y-27632 MedChemExpress Cat#HY-10071 TrypLETM Express Enzyme (1X) Gibco Cat#12605028 Dimethyl sulfoxide MedChemExpress Cat#HY-Y0320 TBS Servicebio Cat#G0001 PBS Servicebio Cat#G0002 Protein Phosphatase Inhibitor (All-in-one,100x) Solarbio Cat#P1260 Trypsin-EDTA (0.25%) Gibco Cat#25200072 Dulbecco’s modified Eagle’s medium (DMEM) Gibco Cat#C11995500BT RPMI 1640 medium Gibco Cat#31870082 GlutaMAXTM Supplement Gibco Cat#35050061 HEPES(1M) Gibco Cat#15630080 Puromycin Invitrogen Cat#A1113803 Fetal bovine Serum Cell-Box Cat#CF-01S Phenylmethylsulfonyl fluoride (PMSF) Beyotime Cat#ST505 Penicillin-Streptomycin Liquid Solarbio Cat#P1400 Hygromycin B Gibco Cat#10687010 (Continued on next page) Cell Reports Medicine 6, 101966, February 18, 2025 e2 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Geneticin Gibco Cat#10131027 Collagenase from Clostridium histolyticum (Type XI) Sigma Cat#C7657 Cultrex UltiMatrix Reduced Growth Factor Basement Membrane Extract Biotechne Cat#BME001 Human Pancreatic Cancer Organoid Kit BioGenous Cat#K2101-PC Gastrin I (human) Biotechne Cat#3006 Recombinant Human FGF-10 Peprotech Cat#100-26 Nicotinamide MedChemExpress Cat#HY-B0150 A 83-01 MedChemExpress Cat#HY-10432 Prostaglandin E2 MedChemExpress Cat#HY-101952 Organoid Recovery Solution BioGenous Cat#E238006 RB1 Fusion Protein Proteintech CatAg11211 G6PD Fusion Protein Proteintech Cat#Ag21862 Human Cellular tumor antigen P53/TP53 MedChemExpress Cat#HY-P72257 Recombinant human E2F1 protein Abcam Cat#ab82207 D-Glucose (U-13C6) Cambridge Isotope Laboratories Cat#CLM-1396 D-Glucose (U-13C1,2) Sigma Cat#453188 F-127 Sigma Cat#P2443 Critical commercial assays Lipo2000TM Transfection reagent Product Invitrogen Cat#11668019 PEI 40K Transfection Reagent Servicebio Cat#G1802 Agarose gel DNA recovery kit TIANGEN Cat#DP219 Plasmid Small Extraction Kit TIANGEN Cat#DP103 BCA Protein Assay Kit Solarbio Cat#PC0020 Alcian blue Stain Kit Solarbio Cat#G1560 Total RNA Extraction Reagent Tiangen Cat#DP451 Hematoxylin-Eosin (HE) Stain Kit Solarbio Cat#G1120 CellTiter-Glo 3D Cell Viability Assay Promega Cat#G9682 Dual-Luciferase Reporter Assay System Promega Cat#E1910 NADP/NADPH-GloTM Assays Promega Cat#G9082 TIANamp Genomic DNA Kit TIANGEN Cat#DP304 DNA pulldown kit BersinBio Cat#Bes5004 SpectrumTM Labs Spectra/PorTM 6 1000 D MWCO Standard RC Pre-wetted Dialysis Kits Fisher Scientific Cat#08-700-197 His-Tag Protein Labeling Kit (His-Tag RED Channel) NanoTemper Technologies Cat#MO-L018 Deposited data TCGA-PAAD dataset TCGA https://portal.gdc.cancer.gov/ projects/TCGA-PAAD Raw immunoblotting data Mendeley Data https://doi.org/10.17632/z6s7vb8d77.1 Metabolomic data METASPACE https://metaspace2020.eu/ project/jiao-2024 RNA-sequencing of pancreatic cancer organoids NCBI Sequence Read Archive (SRA) data PRJNA1201558 Experimental models: Cell lines Human: HEK-293T Cell Bank of the Chinese Academy of Sciences Cat#SCSP-502 Human: PANC-1 Cell Bank of the Chinese Academy of Sciences Cat#SCSP-535 Human: AsPC-1 Pricella Cat#CL-0027 Mouse: L-WRN Pricella Cat#CL-0658 (Continued on next page) e3 Cell Reports Medicine 6, 101966, February 18, 2025 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: BxPC-3 Pricella Cat#CL-0042 Patient-derived organoids (PDO) This manuscript N/A Mouse-derived organoids This manuscript N/A Experimental models: Organisms/strains Mouse: C57BL/6JGpt Gempharmatech Cat#N000013; RRID: IMSR_GPT:N000013 Mouse: NOD/ShiLtJGptPrkdcem26Cd52Il2rgem26Cd22/Gpt(NCG) Gempharmatech Cat#T001475; RRID: IMSR_GPT:T001475 Mouse: C57BL/6Smoc-Krasem4(LSL G12D)Smoc Shanghai Model Organisms Center Cat#NM-KI-190003; RRID: IMSR_NM-KI-190003 Mouse: C57BL/6Smoc-Ube2ttm1(flox)Smoc Shanghai Model Organisms Center Cat#NM-CKO-2115005; RRID: IMSR_NM-CKO-2115005 Mouse: C57BL/6.FVB-Tg(Pdx1-cre)6Tuv/J Jackson Laboratory Cat#014647; RRID: IMSR_JAX:014647 Mouse: C57BL/6Smoc-Trp53tm(LSL R172H)Smoc Shanghai Model Organisms Center Cat#NM-KI-220071; RRID: IMSR_NM-KI-220071 Oligonucleotides GenOFF st-h-E2F1_001 Ribobio Cat#stB0001999A-1-5 GenOFF st-h-E2F1_002 Ribobio Cat#stB0001999B-1-5 GenOFF st-h-TP53_001 Ribobio Cat#stB0002017A-1-5 GenOFF st-h-TP53_002 Ribobio Cat#stB0002017B-1-5 GenOFF st-h-RB1_001 Ribobio Cat#stB0002011A-1-5 GenOFF st-h-RB1_002 Ribobio Cat#stB0002011B-1-5 siR Transfect Control Ribobio Cat#siT0000001-1-5 Recombinant DNA pRK5-HA-ubiquitin This manuscript N/A pRK5-UBE2T This manuscript N/A pRK5-RING1 This manuscript N/A WT/deletion-mutant/site-mutant FLAG-p53 plasmids This manuscript N/A pRK5-Flag-KRASG12D This manuscript N/A pRK5-Flag-G6PD This manuscript N/A pRK5-Flag-E2F1 This manuscript N/A pRK5-HA-E2F1 This manuscript N/A pRK5-HA-RING1 This manuscript N/A Dual-luciferase vector pGL-4.10 hedgehogBio HH-LUC-043 pCMV3-His-Rb Sino Biological HG10137-NH Software and algorithms GraphPad Prism 10.1.2 GraphPad Software https://www.graphpad.com/ Snapgene Snapgene by Dotmatics https://www.snapgene.com/ R 4.3.3 Institute for Statistics and Mathematics https://www.r-project.org/ Molecular Operating Environment (MOE, version 2020.0901) Chemical Computing Group ULC, Canada https://www.chemcomp.com/ SPSS 27.0 International Business Machines Corporation https://www.ibm.com/ GSEA 4.3.2 Mootha, Lindgren et al. https://www.gsea-msigdb.org/ Combenefit Cancer Research UK Cambridge Institute https://www.cruk.cam.ac.uk/ SynergyFinder web application (version 3.0) Institute for Molecular Medicine Finland (FIMM) https://synergyfinder.fimm.fi/ Cell Reports Medicine 6, 101966, February 18, 2025 e4 Article ll OPEN ACCESS Article ll OPEN ACCESS
|
Proteintech is a verified supplier 